

2017 ( 108 )

2016 ( 697 )

2015 ( 12108 )

2014 ( 15636 )


匹配条件: “D.K. Sharma” ,找到相关结果约308881条。
Effect of AgI on Conduction Mechanism in Silver-Vanadate Superionic Glasses  [PDF]
Poonam Sharma, D.K. Kanchan, Meenakshi Pant, Manish S. Jayswal, Nirali Gondaliya
New Journal of Glass and Ceramics (NJGC) , 2011, DOI: 10.4236/njgc.2011.13016
Abstract: A quaternary super-ionic glass system xAgI: (95-x) [Ag2O:2V2O5]: 5TeO2, where 40 ≤ x ≤ 65 in steps of 5, has been pre- pared by melt quenching technique. The prepared glass samples are characterized by X-ray, FTIR and DSC studies. As revealed by the FTIR spectra, the oxyanion network is not affected by the addition of AgI. The frequency dependence of the electrical conductivity for various glass compositions at different temperatures has been analyzed in terms of Jon- scher’s universal power law. The measurements reveal that the conductivity increases from σ = 7.62 × 10–7 S/cm to 1.15 × 10–4 S/cm with increasing AgI content. The temperature dependent conductivity obeys the Arrhenius relationship. The impedance and modulus studies indicate the non-debye type of the frequency dispersion for all the glass samples.
The Effect of Mixed Iodide Salts on the Conductivity Behavior in Ag2O-V2O5-B2O3 Superionic Glass System  [PDF]
Poonam Sharma, D.K. Kanchan, Nirali Gondaliya, Meenakshi Pant, Manish S. Jayswal
New Journal of Glass and Ceramics (NJGC) , 2011, DOI: 10.4236/njgc.2011.13018
Abstract: A superionic mixed metal iodide glass system [(PbI2 –CuI ) - Ag2O- V2O5- B2O3] has been prepared by splat quenching technique. The prepared glass samples are characterized by X-ray diffraction (XRD) and differential scanning calo- rimetry (DSC). The effect of mixed metal iodide salts concentration on electrical properties has been investigated by the complex impedance spectroscopy (CIS). AC conductivity analysis is carried out in the frequency range of 2MHz-1Hz at different temperatures and an enhancement in the conductivity with iodide salts is the main feature of the observed re- sults with an anomaly at 20 mole % of PbI2 –CuI.
Biodiversity for livelihoods and food security
Chittaranjan Baruah,D.K. Sharma
Asian Journal of Conservation Biology , 2012,
Synthesis and characterization of screen-printed CdS films
Kumar V.,Sharma D.K.,Bansal M.K.,Dwivedi D.K.
Science of Sintering , 2011, DOI: 10.2298/sos1103335k
Abstract: Cadmium sulphide films having energy band gap of 2.4 eV found applications in solar cells and electroluminescent devices. CdS polycrystalline films have been prepared on ultra-clean glass substrate by screen-printing technique and then sintered in air. Optimum conditions for preparing good quality screen-printed films have been found. The optical band gaps ‘Eg’ of the CdS films were determined from the UV transmission spectroscopy and were found to be 2.47eV. The Wurtzite structure of CdS films was confirmed by X-ray diffraction analysis. DC conductivity and activation energy of films was also measured in vacuum by two-probe technique.
Biological management of Orobanche with Fusarium oxysporum - a new record from India
Indian Phytopathology , 2011,
Mr. D.K. Sharma,Prof. Aziz Ahmad
International Journal of Engineering Science and Technology , 2011,
Abstract: The paper describes the damping of power system oscillations of the single machine and multi- machine power system using STATCOM, the static synchronous compensator with combined PI and Fuzzy Logic controlled voltage regulator. The proposed controller is used to damp the power system oscillations and regulate the bus bar voltage at which STATCOM is connected. The rate of dissipation of transient energy in post fault period giving additional damping will actually evaluate the efficiency and performance of the STATCOM. The basic objective of the STATCOM is to support bus bar voltage by injecting appropriate reactive power; it can also improve the dynamic behavior of a power system. The performance of the proposed controller has been compared with combined conventional PI voltage regulator and SFLC on a Western System Coordinating Council (WSCC) 3-phase 9-bus system through simulation by using MATLAB.
An Extended SQL for Fuzzy Multidatabases
Awadhesh Kumar Sharma,A. Goswami,D.K. Gupta
International Journal of Engineering Science and Technology , 2010,
Abstract: Many real world problems involve imprecise and ambiguous information rather than crisp information. Recent trends in the database paradigm are to incorporate fuzzy sets to tackle imprecise and ambiguous information of real world problems. Fuzzy query processing in multidatabases have been extensively studied, however, the same has rarely been addressed for fuzzy multidatabases. In this paper we have made an attempt to extend the SQL to formulate a global fuzzy query on a fuzzy multidatabase under FTS relational model discussed arlier. We have provided architecture for distributed fuzzy query processing with a strategy for fuzzy query decomposition and optimization. Proofs of consistent global fuzzy operations and some of algebraic properties of FTS Relational Model are also supplemented.
Extending the Real Rime Congestion Control Mechanism for Multicast Applications over 3G Wireless Networks
Neetu Sharma,Amit Sharma,Vijay Singh Rathore,D.K Mishra
World of Computer Science and Information Technology Journal , 2011,
Abstract: In this paper we introduce a real time congestion control mechanism to multicast the multimedia applications. The key challenge in the design of this mechanism is to calculate the rate of feedback messages by various receivers; appropriate feed back suppression, scalable round trip time measurements & ensuring that feedback delays in the control loop do not adversely affect fairness towards competing flows. Major contributions are the feedback mechanism and provide an end-to-end multicast congestion control schemes. We improve the well-known approach for multicasting, by using exponentially weighted random timers by biasing feedback for low-rate receiver and preventing the response implosion. We evaluate the design using simulation and demonstrate the results for multicast transmission of multimedia data.
Characterization of biovar/ races of Ralstonia solanacearum, the incitant of bacterial wilt in solanaceous crops
Indian Phytopathology , 2011,
Abstract: A survey was conducted to study the status of bacterial wilt of solanaceous crops (potato, tomato, brinjal, chilli and capsicum) caused by R. solanacearum in Northern and Eastern states of India such as Jammu & Kashmir, Himachal Pradesh, Uttarakhand, Jharkhand and West Bengal. Bacterial wilt disease incidence in tomato and chilli was quite low 1 to 3 percent during summer season, whereas in rainy season, it was 4 to 60 percent in tomato and 3 to 40 per cent in brinjal. Disease incidence in tomato crop was more as compared to other solanaceous crops like brinjal, chilli, capsicum, and potato. Eighty four strains of R. solanacearum were collected from all the five states and 65 isolates were used for biovar /race characterization and molecular detection. Out of these 65 isolates, 58 were categorized as biovar 3 and remaining 7 biovar 4. The biovar 3 and 4, causing wilt in solanaceous crops belong to race 1. PCR with R. solanacearum specific primers Y2 (5’- CCCACTGCTGCCTCCCGTAGGAGT-3’) and OLI1 (5’GGGGGTAGCTTGCTACCTGCC3’) were used for molecular detection and all isolates amplified at 288bp. The primer was also able to distinguish the R. solanacearum from other saprophytic bacteria through colony PCR within 2 days.
Effect of Orientation on Elastic-plastic Fracture Toughness of Cortical Bone
N.K. Sharma,D.K. Sehgal,R.K. Pandey
Lecture Notes in Engineering and Computer Science , 2011,

Copyright © 2008-2017 jourlib.org. All rights reserved.